| Accession | MI0000573 | ||||
| Name | mmu-mir-26a-1 | ||||
| similar to following miRCarta precursors | mmu-34-546.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr9:119,031,796-119,031,885 (+) |
||||
| miRNA | mmu-miR-26a-5p | ||||
| miRNA | mmu-miR-26a-1-3p | ||||
| Sequence (5' -> 3') (90 nts) |
AAGGCCGUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAGGGGCCUAUUCUUGGUUACUUGCACGGGGACGCGGGCCUG | ||||
| MFE | -48.60 kcal/mol | ||||
| first miRBase version | 2.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-26a-1 |
||||
| Family | mir-26 (MIPF0000043) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |