Precursor miRBase

mmu-mir-23a (MI0000571)

Accession MI0000571
Name mmu-mir-23a
similar to following miRCarta precursors mmu-24846-31.1
Organism Mus musculus
Genome GRCm38.p5
Location chr8:84,208,518-84,208,592 (+)
miRNA mmu-miR-23a-5p
miRNA mmu-miR-23a-3p
Sequence (5' -> 3')
(75 nts)
CGGACGGCUGGGGUUCCUGGGGAUGGGAUUUGAUGCCAGUCACAAAUCACAUUGCCAGGGAUUUCCAACUGACCC
MFE -32.60 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(4 precursors)
mmu-mir-23a
mmu-mir-27a
mmu-mir-24-2
mmu-mir-3074-2
Family mir-23 (MIPF0000027)
Experiments
experiment Pubmed link
Illumina 20413612
454 20668074
External DBs
Gene symbol Mir23a
NCBI Gene 387216

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.
5 Zhu et al. J. Virol. 2010 20668074 Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.