Precursor miRBase

mmu-mir-21a (MI0000569)

Accession MI0000569
Name mmu-mir-21a
similar to following miRCarta precursors mmu-25101-25100.1
Organism Mus musculus
Genome GRCm38.p5
Location chr11:86,584,067-86,584,158 (-)
miRNA mmu-miR-21a-5p
miRNA mmu-miR-21a-3p
Sequence (5' -> 3')
(92 nts)
UGUACCACCUUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC
MFE -46.20 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-21a
Family mir-21 (MIPF0000060)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir21a
NCBI Gene 387140

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
5 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
6 Sathyan et al. J. Neurosci. 2007 17687032 Competing interactions between micro-RNAs determine neural progenitor survival and proliferation after ethanol exposure: evidence from an ex vivo model of the fetal cerebral cortical neuroepithelium.
7 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
8 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
9 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.