| Accession | MI0000566 | ||||||
| Name | mmu-mir-16-2 | ||||||
| similar to following miRCarta precursors | mmu-61-24413.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr3:69,009,902-69,009,996 (+) |
||||||
| miRNA | mmu-miR-16-5p | ||||||
| miRNA | mmu-miR-16-2-3p | ||||||
| Sequence (5' -> 3') (95 nts) |
CAUGCUUGUUCCACUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAAAUAUUAAACACCAAUAUUAUUGUGCUGCUUUAGUGUGACAGGGAUA | ||||||
| MFE | -36.50 kcal/mol | ||||||
| first miRBase version | 2.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-15b
mmu-mir-16-2 |
||||||
| Family | mir-15 (MIPF0000006) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
| 3 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 4 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 6 | Zhu et al. | J. Virol. | 2010 | 20668074 | Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. |
| 7 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 8 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |