| Accession | MI0000562 | ||||||
| Name | mmu-let-7f-1 | ||||||
| similar to following miRCarta precursors | mmu-20-275.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr13:48,537,829-48,537,917 (-) |
||||||
| miRNA | mmu-let-7f-5p | ||||||
| miRNA | mmu-let-7f-1-3p | ||||||
| Sequence (5' -> 3') (89 nts) |
AUCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUUAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGAG | ||||||
| MFE | -41.50 kcal/mol | ||||||
| first miRBase version | 2.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
mmu-let-7d
mmu-let-7f-1 mmu-let-7a-1 |
||||||
| Family | let-7 (MIPF0000002) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 3 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |