Accession | MI0000551 | ||||
Name | mmu-mir-192 | ||||
similar to following miRCarta precursors | mmu-59-507.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr19:6,264,844-6,264,932 (+) |
||||
miRNA | mmu-miR-192-5p | ||||
miRNA | mmu-miR-192-3p | ||||
Sequence (5' -> 3') (89 nts) |
CGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUACUCUUUUCUCUCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCACC | ||||
MFE | -37.40 kcal/mol | ||||
first miRBase version | 2.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
mmu-mir-194-2
mmu-mir-192 |
||||
Family | mir-192 (MIPF0000063) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |