Precursor miRBase

mmu-mir-19b-2 (MI0000546)

Accession MI0000546
Name mmu-mir-19b-2
similar to following miRCarta precursors mmu-25639-121.1
Organism Mus musculus
Genome GRCm38.p5
Location chrX:52,741,983-52,742,066 (-)
miRNA mmu-miR-19b-2-5p
miRNA mmu-miR-19b-3p
Sequence (5' -> 3')
(84 nts)
ACUUACGAUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGAAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGGGA
MFE -40.80 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(6 precursors)
mmu-mir-363
mmu-mir-92a-2
mmu-mir-19b-2
mmu-mir-20b
mmu-mir-18b
mmu-mir-106a
Family mir-19 (MIPF0000011)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir19b-2
NCBI Gene 387195

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
3 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
4 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.