Precursor miRBase

mmu-mir-301a (MI0000401)

Accession MI0000401
Name mmu-mir-301a
similar to following miRCarta precursors mmu-429-277.1
Organism Mus musculus
Genome GRCm38.p5
Location chr11:87,113,004-87,113,089 (+)
miRNA mmu-miR-301a-5p
miRNA mmu-miR-301a-3p
Sequence (5' -> 3')
(86 nts)
CCUGCUAACGGCUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCGAGCAGUGCAAUAGUAUUGUCAAAGCAUCCGCGAGCAGG
MFE -37.00 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-301a
Family mir-130 (MIPF0000034)
Experiments
experiment Pubmed link
Illumina 20413612
454 20668074
External DBs
Gene symbol Mir301
NCBI Gene 723834

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
2 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Zhu et al. J. Virol. 2010 20668074 Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68.
5 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
6 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.