Precursor miRBase

mmu-mir-24-2 (MI0000572)

Accession MI0000572
Name mmu-mir-24-2
similar to following miRCarta precursors mmu-24848-35.1
Organism Mus musculus
Genome GRCm38.p5
Location chr8:84,208,815-84,208,921 (+)
miRNA mmu-miR-24-2-5p
miRNA mmu-miR-24-3p
Sequence (5' -> 3')
(107 nts)
GCCUCUCUCCGGGCUCCGCCUCCCGUGCCUACUGAGCUGAAACAGUUGAUUCCAGUGCACUGGCUCAGUUCAGCAGGAACAGGAGUCCAGCCCCCUAGGAGCUGGCA
MFE -49.00 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(4 precursors)
mmu-mir-23a
mmu-mir-27a
mmu-mir-24-2
mmu-mir-3074-2
Family mir-24 (MIPF0000041)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir24-2
NCBI Gene 723960

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
5 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
6 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
7 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.
8 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.