Precursor miRBase

hsa-mir-138-2 (MI0000455)

Accession MI0000455
Name hsa-mir-138-2
similar to following miRCarta precursors hsa-509-1015.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr16:56,858,518-56,858,601 (+)
miRNA hsa-miR-138-5p
miRNA hsa-miR-138-2-3p
Sequence (5' -> 3')
(84 nts)
CGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCA
MFE -34.00 kcal/mol
first miRBase version 2.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-138-2
Family mir-138 (MIPF0000075)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR138-2
NCBI Gene 406930

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.