Precursor miRBase

hsa-mir-15b (MI0000438)

Accession MI0000438
Name hsa-mir-15b
similar to following miRCarta precursors hsa-110-204.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr3:160,404,588-160,404,685 (+)
miRNA hsa-miR-15b-5p
miRNA hsa-miR-15b-3p
Sequence (5' -> 3')
(98 nts)
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU
MFE -29.30 kcal/mol
first miRBase version 2.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-15b
hsa-mir-16-2
Family mir-15 (MIPF0000006)
Experiments
experiment Pubmed link
cloned 17616659 17604727
External DBs
Gene symbol MIR15B
NCBI Gene 406949

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.