| Accession | MI0000433 | ||||
| Name | hsa-let-7g | ||||
| similar to following miRCarta precursors | hsa-58-224.1 | ||||
| potential naming conflicts with | hsa-let-7g-5p (MIMAT0000414) | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr3:52,268,278-52,268,361 (-) |
||||
| miRNA | hsa-let-7g-5p | ||||
| miRNA | hsa-let-7g-3p | ||||
| Sequence (5' -> 3') (84 nts) |
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCA | ||||
| MFE | -39.30 kcal/mol | ||||
| first miRBase version | 2.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-let-7g |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Koh et al. | BMC Genomics | 2010 | 20158877 | Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. |