| Accession | MI0000342 | ||||
| Name | hsa-mir-200b | ||||
| similar to following miRCarta precursors | hsa-312-93.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:1,167,104-1,167,198 (+) |
||||
| miRNA | hsa-miR-200b-5p | ||||
| miRNA | hsa-miR-200b-3p | ||||
| Sequence (5' -> 3') (95 nts) |
CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGAGUCAGGUCUCUAAUACUGCCUGGUAAUGAUGACGGCGGAGCCCUGCACG | ||||
| MFE | -42.90 kcal/mol | ||||
| first miRBase version | 1.4 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-200b hsa-mir-200a hsa-mir-429 |
||||
| Family | mir-8 (MIPF0000019) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
| 2 | Grad et al. | Mol. Cell | 2003 | 12769849 | Computational and experimental identification of C. elegans microRNAs. |
| 3 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |