| Accession | MI0000301 | ||||||
| Name | hsa-mir-224 | ||||||
| similar to following miRCarta precursors | hsa-238-500.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chrX:151,958,578-151,958,658 (-) |
||||||
| miRNA | hsa-miR-224-5p | ||||||
| miRNA | hsa-miR-224-3p | ||||||
| Sequence (5' -> 3') (81 nts) |
GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGUGCCCUAGUGACUACAAAGCCC | ||||||
| MFE | -36.40 kcal/mol | ||||||
| first miRBase version | 1.2 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-224 hsa-mir-452 |
||||||
| Family | mir-224 (MIPF0000088) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 2 | Altuvia et al. | Nucleic Acids Res. | 2005 | 15891114 | Clustering and conservation patterns of human microRNAs. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Tzur et al. | PLoS ONE | 2008 | 19015728 | MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells. |
| 6 | Zhu et al. | J. Virol. | 2009 | 19144710 | Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas. |