Precursor miRBase

hsa-mir-222 (MI0000299)

Accession MI0000299
Name hsa-mir-222
similar to following miRCarta precursors hsa-385-140.1
Organism Homo sapiens
Genome GRCh38.p10
Location chrX:45,747,015-45,747,124 (-)
miRNA hsa-miR-222-5p
miRNA hsa-miR-222-3p
Sequence (5' -> 3')
(110 nts)
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU
MFE -53.80 kcal/mol
first miRBase version 1.2
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-221
hsa-mir-222
Family mir-221 (MIPF0000051)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR222
NCBI Gene 407007

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
3 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
4 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.