| Accession | MI0000299 | ||||
| Name | hsa-mir-222 | ||||
| similar to following miRCarta precursors | hsa-385-140.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:45,747,015-45,747,124 (-) |
||||
| miRNA | hsa-miR-222-5p | ||||
| miRNA | hsa-miR-222-3p | ||||
| Sequence (5' -> 3') (110 nts) |
GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU | ||||
| MFE | -53.80 kcal/mol | ||||
| first miRBase version | 1.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-221
hsa-mir-222 |
||||
| Family | mir-221 (MIPF0000051) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
| 3 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |