Precursor miRBase

hsa-mir-181a-1 (MI0000289)

Accession MI0000289
Name hsa-mir-181a-1
similar to following miRCarta precursors hsa-32-125.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr1:198,859,044-198,859,153 (-)
miRNA hsa-miR-181a-5p
miRNA hsa-miR-181a-3p
Sequence (5' -> 3')
(110 nts)
UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA
MFE -35.00 kcal/mol
first miRBase version 1.2
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-181b-1
hsa-mir-181a-1
Family mir-181 (MIPF0000007)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR181A1
NCBI Gene 406995

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
3 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
4 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Marton et al. Leukemia 2008 17989717 Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis.