| Accession | MI0000286 | ||||
| Name | hsa-mir-210 | ||||
| similar to following miRCarta precursors | hsa-512-102.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr11:568,089-568,198 (-) |
||||
| miRNA | hsa-miR-210-5p | ||||
| miRNA | hsa-miR-210-3p | ||||
| Sequence (5' -> 3') (110 nts) |
ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC | ||||
| MFE | -57.80 kcal/mol | ||||
| first miRBase version | 1.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-210 |
||||
| Family | mir-210 (MIPF0000086) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Cai et al. | Proc. Natl. Acad. Sci. U.S.A. | 2005 | 15800047 | Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |