Precursor miRBase

hsa-mir-210 (MI0000286)

Accession MI0000286
Name hsa-mir-210
similar to following miRCarta precursors hsa-512-102.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr11:568,089-568,198 (-)
miRNA hsa-miR-210-5p
miRNA hsa-miR-210-3p
Sequence (5' -> 3')
(110 nts)
ACCCGGCAGUGCCUCCAGGCGCAGGGCAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUGCCUGGGCAGCGCGACCC
MFE -57.80 kcal/mol
first miRBase version 1.2
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-210
Family mir-210 (MIPF0000086)
Experiments
experiment Pubmed link
Illumina 23034410
External DBs
Gene symbol MIR210
NCBI Gene 406992

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Cai et al. Proc. Natl. Acad. Sci. U.S.A. 2005 15800047 Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.