| Accession | MI0000255 | ||||
| Name | hsa-mir-30d | ||||
| similar to following miRCarta precursors | hsa-21-254.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr8:134,804,876-134,804,945 (-) |
||||
| miRNA | hsa-miR-30d-5p | ||||
| miRNA | hsa-miR-30d-3p | ||||
| Sequence (5' -> 3') (70 nts) |
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC | ||||
| MFE | -28.10 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-30b
hsa-mir-30d |
||||
| Family | mir-30 (MIPF0000005) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 4 | Marton et al. | Leukemia | 2008 | 17989717 | Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis. |