Precursor miRBase

hsa-mir-30d (MI0000255)

Accession MI0000255
Name hsa-mir-30d
similar to following miRCarta precursors hsa-21-254.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr8:134,804,876-134,804,945 (-)
miRNA hsa-miR-30d-5p
miRNA hsa-miR-30d-3p
Sequence (5' -> 3')
(70 nts)
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC
MFE -28.10 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-30b
hsa-mir-30d
Family mir-30 (MIPF0000005)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR30D
NCBI Gene 407033

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Marton et al. Leukemia 2008 17989717 Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis.