| Accession | MI0000248 | ||||
| Name | mmu-mir-205 | ||||
| similar to following miRCarta precursors | mmu-351-24218.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr1:193,507,463-193,507,530 (-) |
||||
| miRNA | mmu-miR-205-5p | ||||
| miRNA | mmu-miR-205-3p | ||||
| Sequence (5' -> 3') (68 nts) |
CUCUUGUCCUUCAUUCCACCGGAGUCUGUCUUAUGCCAACCAGAUUUCAGUGGAGUGAAGCUCAGGAG | ||||
| MFE | -33.80 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-205 |
||||
| Family | mir-205 (MIPF0000058) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |