Precursor miRBase

mmu-mir-200b (MI0000243)

Accession MI0000243
Name mmu-mir-200b
similar to following miRCarta precursors mmu-24524-93.1
Organism Mus musculus
Genome GRCm38.p5
Location chr4:156,055,681-156,055,750 (-)
miRNA mmu-miR-200b-5p
miRNA mmu-miR-200b-3p
Sequence (5' -> 3')
(70 nts)
GCCGUGGCCAUCUUACUGGGCAGCAUUGGAUAGUGUCUGAUCUCUAAUACUGCCUGGUAAUGAUGACGGC
MFE -30.60 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
mmu-mir-429
mmu-mir-200a
mmu-mir-200b
Family mir-8 (MIPF0000019)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir200b
NCBI Gene 387243

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.