Accession | MI0000243 | ||||||
Name | mmu-mir-200b | ||||||
similar to following miRCarta precursors | mmu-24524-93.1 | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chr4:156,055,681-156,055,750 (-) |
||||||
miRNA | mmu-miR-200b-5p | ||||||
miRNA | mmu-miR-200b-3p | ||||||
Sequence (5' -> 3') (70 nts) |
GCCGUGGCCAUCUUACUGGGCAGCAUUGGAUAGUGUCUGAUCUCUAAUACUGCCUGGUAAUGAUGACGGC | ||||||
MFE | -30.60 kcal/mol | ||||||
first miRBase version | 1.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (3 precursors) |
mmu-mir-429
mmu-mir-200a mmu-mir-200b |
||||||
Family | mir-8 (MIPF0000019) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |