| Accession | MI0000241 | ||||||||
| Name | mmu-mir-199a-1 | ||||||||
| similar to following miRCarta precursors | mmu-24905-47.1 | ||||||||
| Organism | Mus musculus | ||||||||
| Genome | GRCm38.p5 | ||||||||
| Location |
chr9:21,496,495-21,496,564 (-) |
||||||||
| miRNA | mmu-miR-199a-5p | ||||||||
| miRNA | mmu-miR-199a-3p | ||||||||
| Sequence (5' -> 3') (70 nts) |
GCCAUCCCAGUGUUCAGACUACCUGUUCAGGAGGCUGGGACAUGUACAGUAGUCUGCACAUUGGUUAGGC | ||||||||
| MFE | -28.90 kcal/mol | ||||||||
| first miRBase version | 1.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-199a-1 |
||||||||
| Family | mir-199 (MIPF0000040) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 2 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
| 3 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |