| Accession | MI0000239 | ||||
| Name | hsa-mir-197 | ||||
| similar to following miRCarta precursors | hsa-1095-99.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:109,598,893-109,598,967 (+) |
||||
| miRNA | hsa-miR-197-5p | ||||
| miRNA | hsa-miR-197-3p | ||||
| Sequence (5' -> 3') (75 nts) |
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC | ||||
| MFE | -41.40 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-197 |
||||
| Family | mir-197 (MIPF0000123) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |