Precursor miRBase

hsa-mir-197 (MI0000239)

Accession MI0000239
Name hsa-mir-197
similar to following miRCarta precursors hsa-1095-99.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr1:109,598,893-109,598,967 (+)
miRNA hsa-miR-197-5p
miRNA hsa-miR-197-3p
Sequence (5' -> 3')
(75 nts)
GGCUGUGCCGGGUAGAGAGGGCAGUGGGAGGUAAGAGCUCUUCACCCUUCACCACCUUCUCCACCCAGCAUGGCC
MFE -41.40 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-197
Family mir-197 (MIPF0000123)
External DBs
Gene symbol MIR197
NCBI Gene 406974

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.