| Accession | MI0000236 | ||||
| Name | mmu-mir-194-1 | ||||
| similar to following miRCarta precursors | mmu-131-24214.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr1:185,313,319-185,313,385 (+) |
||||
| miRNA | mmu-miR-194-5p | ||||
| miRNA | mmu-miR-194-1-3p | ||||
| Sequence (5' -> 3') (67 nts) |
AUCGGGUGUAACAGCAACUCCAUGUGGACUGUGCUCGGAUUCCAGUGGAGCUGCUGUUACUUCUGAU | ||||
| MFE | -34.10 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-194-1 mmu-mir-215 |
||||
| Family | mir-194 (MIPF0000055) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 2 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |