Accession | MI0000234 | ||||
Name | hsa-mir-192 | ||||
similar to following miRCarta precursors | hsa-59-507.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr11:64,891,137-64,891,246 (-) |
||||
miRNA | hsa-miR-192-5p | ||||
miRNA | hsa-miR-192-3p | ||||
Sequence (5' -> 3') (110 nts) |
GCCGAGACCGAGUGCACAGGGCUCUGACCUAUGAAUUGACAGCCAGUGCUCUCGUCUCCCCUCUGGCUGCCAAUUCCAUAGGUCACAGGUAUGUUCGCCUCAAUGCCAGC | ||||
MFE | -38.80 kcal/mol | ||||
first miRBase version | 1.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
hsa-mir-192 hsa-mir-194-2 hsa-mir-6750 |
||||
Family | mir-192 (MIPF0000063) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
2 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
3 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |