| Accession | MI0000231 | ||||||||
| Name | mmu-mir-24-1 | ||||||||
| similar to following miRCarta precursors | mmu-283-35.1 | ||||||||
| Organism | Mus musculus | ||||||||
| Genome | GRCm38.p5 | ||||||||
| Location |
chr13:63,301,208-63,301,275 (+) |
||||||||
| miRNA | mmu-miR-24-1-5p | ||||||||
| miRNA | mmu-miR-24-3p | ||||||||
| Sequence (5' -> 3') (68 nts) |
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAG | ||||||||
| MFE | -26.30 kcal/mol | ||||||||
| first miRBase version | 1.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (4 precursors) |
mmu-mir-23b
mmu-mir-27b mmu-mir-3074-1 mmu-mir-24-1 |
||||||||
| Family | mir-24 (MIPF0000041) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 3 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
| 4 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 5 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 6 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 7 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 8 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 9 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |