Precursor miRBase

mmu-mir-24-1 (MI0000231)

Accession MI0000231
Name mmu-mir-24-1
similar to following miRCarta precursors mmu-283-35.1
Organism Mus musculus
Genome GRCm38.p5
Location chr13:63,301,208-63,301,275 (+)
miRNA mmu-miR-24-1-5p
miRNA mmu-miR-24-3p
Sequence (5' -> 3')
(68 nts)
CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUCACACACUGGCUCAGUUCAGCAGGAACAGGAG
MFE -26.30 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(4 precursors)
mmu-mir-23b
mmu-mir-27b
mmu-mir-3074-1
mmu-mir-24-1
Family mir-24 (MIPF0000041)
Experiments
experiment Pubmed link
Illumina 20215419
cloned 17604727 12007417 16766679 15538371 12919684
Northern blot 12919684
External DBs
Gene symbol Mir24-1
NCBI Gene 387142

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
5 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
6 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
7 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
8 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
9 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.