Precursor miRBase

mmu-mir-184 (MI0000226)

Accession MI0000226
Name mmu-mir-184
similar to following miRCarta precursors mmu-24935-460.1
Organism Mus musculus
Genome GRCm38.p5
Location chr9:89,802,260-89,802,328 (-)
miRNA mmu-miR-184-5p
miRNA mmu-miR-184-3p
Sequence (5' -> 3')
(69 nts)
CCUUUCCUUAUCACUUUUCCAGCCAGCUUUGUGACUCUAAGUGUUGGACGGAGAACUGAUAAGGGUAGG
MFE -29.00 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-184
Family mir-184 (MIPF0000059)
External DBs
Gene symbol Mir184
NCBI Gene 387179

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.