| Accession | MI0000162 | ||||||
| Name | mmu-mir-136 | ||||||
| similar to following miRCarta precursors | mmu-269-25207.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,595,327-109,595,388 (+) |
||||||
| miRNA | mmu-miR-136-5p | ||||||
| miRNA | mmu-miR-136-3p | ||||||
| Sequence (5' -> 3') (62 nts) |
GAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAAGCUCCAUCAUCGUCUCAAAUGAGUCUUC | ||||||
| MFE | -28.20 kcal/mol | ||||||
| first miRBase version | 1.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (13 precursors) |
mmu-mir-337
mmu-mir-3544 mmu-mir-540 mmu-mir-665 mmu-mir-3070-1 mmu-mir-3070-2 mmu-mir-431 mmu-mir-433 mmu-mir-127 mmu-mir-434 mmu-mir-432 mmu-mir-3071 mmu-mir-136 |
||||||
| Family | mir-136 (MIPF0000099) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 3 | Davis et al. | Curr. Biol. | 2005 | 15854907 | RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |