| Accession | MI0000161 | ||||||
| Name | mmu-mir-135a-1 | ||||||
| similar to following miRCarta precursors | mmu-520-24942.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr9:106,154,124-106,154,213 (+) |
||||||
| miRNA | mmu-miR-135a-5p | ||||||
| miRNA | mmu-miR-135a-1-3p | ||||||
| Sequence (5' -> 3') (90 nts) |
AGGCCUCACUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUAUUGCUCGCUCAUAUAGGGAUUGGAGCCGUGGCGUACGGUGAGGAUA | ||||||
| MFE | -42.60 kcal/mol | ||||||
| first miRBase version | 1.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-135a-1 |
||||||
| Family | mir-135 (MIPF0000028) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |