Accession | MI0000142 | ||||||
Name | mmu-mir-27b | ||||||
similar to following miRCarta precursors | mmu-240-39.1 | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chr13:63,300,712-63,300,784 (+) |
||||||
miRNA | mmu-miR-27b-5p | ||||||
miRNA | mmu-miR-27b-3p | ||||||
Sequence (5' -> 3') (73 nts) |
AGGUGCAGAGCUUAGCUGAUUGGUGAACAGUGAUUGGUUUCCGCUUUGUUCACAGUGGCUAAGUUCUGCACCU | ||||||
MFE | -39.50 kcal/mol | ||||||
first miRBase version | 1.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (4 precursors) |
mmu-mir-23b
mmu-mir-27b mmu-mir-3074-1 mmu-mir-24-1 |
||||||
Family | mir-27 (MIPF0000036) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
3 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
4 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |