| Accession | MI0000141 | ||||
| Name | mmu-mir-23b | ||||
| similar to following miRCarta precursors | mmu-25291-42.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr13:63,300,484-63,300,557 (+) |
||||
| miRNA | mmu-miR-23b-5p | ||||
| miRNA | mmu-miR-23b-3p | ||||
| Sequence (5' -> 3') (74 nts) |
GGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUGAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACC | ||||
| MFE | -28.80 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (4 precursors) |
mmu-mir-23b mmu-mir-27b mmu-mir-3074-1 mmu-mir-24-1 |
||||
| Family | mir-23 (MIPF0000027) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
| 2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 3 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 6 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |