Precursor miRBase

mmu-mir-23b (MI0000141)

Accession MI0000141
Name mmu-mir-23b
similar to following miRCarta precursors mmu-25291-42.1
Organism Mus musculus
Genome GRCm38.p5
Location chr13:63,300,484-63,300,557 (+)
miRNA mmu-miR-23b-5p
miRNA mmu-miR-23b-3p
Sequence (5' -> 3')
(74 nts)
GGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUGAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACC
MFE -28.80 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(4 precursors)
mmu-mir-23b
mmu-mir-27b
mmu-mir-3074-1
mmu-mir-24-1
Family mir-23 (MIPF0000027)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir23b
NCBI Gene 387217

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
3 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
6 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.