Precursor miRBase

dme-mir-10 (MI0000130)

Accession MI0000130
Name dme-mir-10
similar to following miRCarta precursors dme-34764-30113.1
Organism Drosophila melanogaster
Genome BDGP5.0
Location 3R:2,635,228-2,635,304 (-)
miRNA dme-miR-10-5p
miRNA dme-miR-10-3p
Sequence (5' -> 3')
(77 nts)
CCACGUCUACCCUGUAGAUCCGAAUUUGUUUUAUACUAGCUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGG
MFE -31.40 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
dme-mir-10
Family mir-10 (MIPF0000033)
Experiments
experiment Pubmed link
Illumina 17989255
cloned 11679670 12919683
Northern blot 11679670 12812784 12919683
454 17989254 17989255

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Aravin et al. Dev. Cell 2003 12919683 The small RNA profile during Drosophila melanogaster development.
3 Sempere et al. Dev. Biol. 2003 12812784 Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity.
4 Stark et al. Genome Res. 2007 17989255 Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes.
5 Ruby et al. Genome Res. 2007 17989254 Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs.