Accession | MI0000113 | ||||
Name | hsa-mir-106a | ||||
similar to following miRCarta precursors | hsa-242-1074.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chrX:134,170,198-134,170,278 (-) |
||||
miRNA | hsa-miR-106a-5p | ||||
miRNA | hsa-miR-106a-3p | ||||
Sequence (5' -> 3') (81 nts) |
CCUUGGCCAUGUAAAAGUGCUUACAGUGCAGGUAGCUUUUUGAGAUCUACUGCAAUGUAAGCACUUCUUACAUUACCAUGG | ||||
MFE | -34.40 kcal/mol | ||||
first miRBase version | 1.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
hsa-mir-363
hsa-mir-92a-2 hsa-mir-19b-2 hsa-mir-20b hsa-mir-18b hsa-mir-106a |
||||
Family | mir-17 (MIPF0000001) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
2 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |