Precursor miRBase

hsa-mir-103a-1 (MI0000109)

Accession MI0000109
Name hsa-mir-103a-1
similar to following miRCarta precursors hsa-13.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr5:168,560,896-168,560,973 (-)
miRNA hsa-miR-103a-3p
Sequence (5' -> 3')
(78 nts)
UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUG
MFE -29.40 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-103a-1
hsa-mir-103b-1
Family mir-103 (MIPF0000024)
Experiments
experiment Pubmed link
Illumina 20158877
cloned 17604727 17616659 11914277 15183728
Northern blot 15183728
External DBs
Gene symbol MIR103A1
NCBI Gene 406895

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
2 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.