| Accession | MI0000109 | ||||||||
| Name | hsa-mir-103a-1 | ||||||||
| similar to following miRCarta precursors | hsa-13.1 | ||||||||
| Organism | Homo sapiens | ||||||||
| Genome | GRCh38.p10 | ||||||||
| Location |
chr5:168,560,896-168,560,973 (-) |
||||||||
| miRNA | hsa-miR-103a-3p | ||||||||
| Sequence (5' -> 3') (78 nts) |
UACUGCCCUCGGCUUCUUUACAGUGCUGCCUUGUUGCAUAUGGAUCAAGCAGCAUUGUACAGGGCUAUGAAGGCAUUG | ||||||||
| MFE | -29.40 kcal/mol | ||||||||
| first miRBase version | 1.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-103a-1 hsa-mir-103b-1 |
||||||||
| Family | mir-103 (MIPF0000024) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 2 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
| 3 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Koh et al. | BMC Genomics | 2010 | 20158877 | Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. |