Precursor miRBase

hsa-mir-98 (MI0000100)

Accession MI0000100
Name hsa-mir-98
similar to following miRCarta precursors hsa-143-367.1
Organism Homo sapiens
Genome GRCh38.p10
Location chrX:53,556,223-53,556,341 (-)
miRNA hsa-miR-98-5p
miRNA hsa-miR-98-3p
Sequence (5' -> 3')
(119 nts)
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA
MFE -56.70 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-98
hsa-let-7f-2
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
SOLiD 22282338
External DBs
Gene symbol MIR98
NCBI Gene 407054

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Voellenkle et al. RNA 2012 22282338 Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs.