| Accession | MI0000100 | ||||
| Name | hsa-mir-98 | ||||
| similar to following miRCarta precursors | hsa-143-367.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:53,556,223-53,556,341 (-) |
||||
| miRNA | hsa-miR-98-5p | ||||
| miRNA | hsa-miR-98-3p | ||||
| Sequence (5' -> 3') (119 nts) |
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUAGGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA | ||||
| MFE | -56.70 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-98 hsa-let-7f-2 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Voellenkle et al. | RNA | 2012 | 22282338 | Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. |