Accession | MI0000093 | ||||
Name | hsa-mir-92a-1 | ||||
similar to following miRCarta precursors | hsa-409-9.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr13:91,351,314-91,351,391 (+) |
||||
miRNA | hsa-miR-92a-1-5p | ||||
miRNA | hsa-miR-92a-3p | ||||
Sequence (5' -> 3') (78 nts) |
CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG | ||||
MFE | -35.50 kcal/mol | ||||
first miRBase version | 1.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
hsa-mir-17
hsa-mir-18a hsa-mir-19a hsa-mir-20a hsa-mir-19b-1 hsa-mir-92a-1 |
||||
Family | mir-25 (MIPF0000013) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
2 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
3 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
4 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
5 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
6 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
7 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
8 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |