Precursor miRBase

  1. Dashboard
  2. Precursor

hsa-mir-29a (MI0000087)

Accession MI0000087
Name hsa-mir-29a
similar to following miRCarta precursors hsa-315-26.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr7:130,876,747-130,876,810 (-)
miRNA hsa-miR-29a-5p
miRNA hsa-miR-29a-3p
Sequence (5' -> 3')
(64 nts)		 AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU
MFE -24.60 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors) 		hsa-mir-29a
hsa-mir-29b-1
Family mir-29 (MIPF0000009)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR29A
NCBI Gene 407021

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
5 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
6 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
7 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
8 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.
Imprint Data protection