| Accession | MI0000086 | ||||
| Name | hsa-mir-28 | ||||
| similar to following miRCarta precursors | hsa-133-28.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr3:188,688,781-188,688,866 (+) |
||||
| miRNA | hsa-miR-28-5p | ||||
| miRNA | hsa-miR-28-3p | ||||
| Sequence (5' -> 3') (86 nts) |
GGUCCUUGCCCUCAAGGAGCUCACAGUCUAUUGAGUUACCUUUCUGACUUUCCCACUAGAUUGUGAGCUCCUGGAGGGCAGGCACU | ||||
| MFE | -50.20 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-28 |
||||
| Family | mir-28 (MIPF0000057) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Afanasyeva et al. | BMC Genomics | 2008 | 18230126 | New miRNAs cloned from neuroblastoma. |