Precursor miRBase

hsa-mir-24-2 (MI0000081)

Accession MI0000081
Name hsa-mir-24-2
similar to following miRCarta precursors hsa-226-36.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr19:13,836,287-13,836,359 (-)
miRNA hsa-miR-24-2-5p
miRNA hsa-miR-24-3p
Sequence (5' -> 3')
(73 nts)
CUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGGUUUGUGUACACUGGCUCAGUUCAGCAGGAACAGGG
MFE -26.00 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
hsa-mir-24-2
hsa-mir-27a
hsa-mir-23a
Family mir-24 (MIPF0000041)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR24-2
NCBI Gene 407013

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
3 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
4 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
5 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
6 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
7 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
8 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.