Precursor miRBase

hsa-mir-21 (MI0000077)

Accession MI0000077
Name hsa-mir-21
similar to following miRCarta precursors hsa-1-52.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr17:59,841,266-59,841,337 (+)
miRNA hsa-miR-21-5p
miRNA hsa-miR-21-3p
Sequence (5' -> 3')
(72 nts)
UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA
MFE -34.60 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-21
Family mir-21 (MIPF0000060)
Experiments
experiment Pubmed link
cloned 17604727 17616659
External DBs
Gene symbol MIR21
NCBI Gene 406991

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
3 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
4 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
5 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
6 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
7 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
8 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
9 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
10 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.