Precursor miRBase

hsa-mir-19b-1 (MI0000074)

Accession MI0000074
Name hsa-mir-19b-1
similar to following miRCarta precursors hsa-363-122.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr13:91,351,192-91,351,278 (+)
miRNA hsa-miR-19b-1-5p
miRNA hsa-miR-19b-3p
Sequence (5' -> 3')
(87 nts)
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAGUG
MFE -38.50 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(6 precursors)
hsa-mir-17
hsa-mir-18a
hsa-mir-19a
hsa-mir-20a
hsa-mir-19b-1
hsa-mir-92a-1
Family mir-19 (MIPF0000011)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR19B1
NCBI Gene 406980

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
3 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
4 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
5 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
6 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
7 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
8 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
9 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.