| Accession | MI0000073 | ||||
| Name | hsa-mir-19a | ||||
| similar to following miRCarta precursors | hsa-1070-201.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr13:91,350,891-91,350,972 (+) |
||||
| miRNA | hsa-miR-19a-5p | ||||
| miRNA | hsa-miR-19a-3p | ||||
| Sequence (5' -> 3') (82 nts) |
GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC | ||||
| MFE | -38.70 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-17
hsa-mir-18a hsa-mir-19a hsa-mir-20a hsa-mir-19b-1 hsa-mir-92a-1 |
||||
| Family | mir-19 (MIPF0000011) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 3 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |