| Accession | MI0000001 | ||||
| Name | cel-let-7 | ||||
| similar to following miRCarta precursors | cel-5-35402.1 | ||||
| potential naming conflicts with | cel-let-7-5p (MIMAT0000001) | ||||
| Organism | Caenorhabditis elegans | ||||
| Genome | WBcel235 | ||||
| Location |
chrX:14,744,173-14,744,271 (-) |
||||
| miRNA | cel-let-7-5p | ||||
| miRNA | cel-let-7-3p | ||||
| Sequence (5' -> 3') (99 nts) |
UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA | ||||
| MFE | -41.90 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
cel-let-7 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lau et al. | Science | 2001 | 11679671 | An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. |
| 2 | Grad et al. | Mol. Cell | 2003 | 12769849 | Computational and experimental identification of C. elegans microRNAs. |
| 3 | Ambros et al. | Curr. Biol. | 2003 | 12747828 | MicroRNAs and other tiny endogenous RNAs in C. elegans. |
| 4 | Lim et al. | Genes Dev. | 2003 | 12672692 | The microRNAs of Caenorhabditis elegans. |
| 5 | Ruby et al. | Cell | 2006 | 17174894 | Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. |
| 6 | Kato et al. | Genome Biol. | 2009 | 19460142 | Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development. |
| 7 | Zisoulis et al. | Nat. Struct. Mol. Biol. | 2010 | 20062054 | Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans. |