miRNA miRCarta

m-898

Accession m-898
Sequence (5' -> 3') (21 nts)  GCUGGGAAGGCAAAGGGACGU
Sequence (5' -> 3') with flanks GGCUGGGAAGGCAAAGGGACGUUCA
similar to miRNAs from miRBase aca-miR-204a-3p (MIMAT0021854)
chi-miR-204-3p (MIMAT0036051)
hsa-miR-204-3p (MIMAT0022693)
mmu-miR-204-3p (MIMAT0017002)
oha-miR-204-1-3p (MIMAT0036813)
rno-miR-204-3p (MIMAT0004739)
sha-miR-204 (MIMAT0022790)
Organisms Anolis carolinensis
Capra hircus
Homo sapiens
Mus musculus
Ophiophagus hannah
Rattus norvegicus
Sarcophilus harrisii
Located in precursor aca-296-898.1
chr2:48,872,028-48,872,048 (+)
Located in precursor chi-296-898.1
cluster_7:46,738,335-46,738,355 (-)
Located in precursor hsa-296-898.1
9:70,809,993-70,810,013 (-)
Located in precursor mmu-296-898.1
19:22,750,649-22,750,669 (+)
Located in precursor oha-296-898.1
AZIM01000745.1:257,789-257,809 (-)
Located in precursor rno-296-898.1
chr1:240,403,071-240,403,091 (+)
Located in precursor sha-898.1
NW_003823524.1:388,149-388,169 (+)
MFE -2.40 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree