| Accession | m-852 |
| Sequence (5' -> 3') (22 nts) | UUCUCGAGGAAAGAAGCACUUU |
| Sequence (5' -> 3') with flanks | CUUCUCGAGGAAAGAAGCACUUUCUG |
| similar to miRNAs from miRBase |
ggo-miR-516a (MIMAT0036443) ggo-miR-516a-5p (MIMAT0036441) hsa-miR-516a-5p (MIMAT0004770) ppy-miR-516a (MIMAT0036453) ppy-miR-516a-5p (MIMAT0015945) |
| Organisms |
Gorilla gorilla Homo sapiens Pongo abelii |
| Located in precursor |
ggo-852-31129.1 19:53,101,200-53,101,221 (+) |
| Located in precursor |
ggo-852.1 19:53,105,611-53,105,632 (+) |
| Located in precursor |
hsa-852-1157.1 19:53,756,756-53,756,777 (+) |
| Located in precursor |
hsa-852-1157.2 19:53,761,148-53,761,169 (+) |
| Located in precursor |
ppy-852-30459.1 19:55,541,621-55,541,642 (+) |
| Located in precursor |
ppy-852.1 19:55,535,327-55,535,348 (+) |
| MFE | 0.00 kcal/mol |
| first miRCarta version | 1.0 |
| last miRCarta version | 1.1 |
| Links | miRNA pathway dictionary (miRPathDB) |