miRNA miRCarta

m-561 in Equus caballus

Accession m-561
Sequence (5' -> 3') (19 nts)  CGGGGCAGCUCAGUACAGG
Sequence (5' -> 3') with flanks UCGGGGCAGCUCAGUACAGGAUG
similar to miRNAs from miRBase eca-miR-486-3p (MIMAT0013187)
hsa-miR-486-3p (MIMAT0004762)
mml-miR-486-3p (MIMAT0006345)
mmu-miR-486a-3p (MIMAT0017206)
tch-miR-486-3p (MIMAT0036553)
Located in precursor eca-107-561.1
27:3,709,614-3,709,632 (+)
MFE -1.70 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree