miRNA miRCarta

m-512 in Macaca mulatta

Accession m-512
Sequence (5' -> 3') (22 nts)  AGCCCCUGCCCACCGCACACUG
Sequence (5' -> 3') with flanks CAGCCCCUGCCCACCGCACACUGCGC
similar to miRNAs from miRBase hsa-miR-210-5p (MIMAT0026475)
mml-miR-210-5p (MIMAT0026846)
Located in precursor mml-512-102.1
Chromosome14:409,451-409,472 (-)
MFE -1.10 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree