miRNA miRCarta

m-41330 in Ovis aries

Accession m-41330
Sequence (5' -> 3') (21 nts)  AUGUCACUCGGCCCACUACCC
Sequence (5' -> 3') with flanks CAUGUCACUCGGCCCACUACCCAAG
similar to miRNAs from miRBase oar-miR-668-3p (MIMAT0019311)
Located in precursor oar-41331-41330.1
Chromosome18:64,552,743-64,552,763 (+)
MFE -0.70 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1

Homologs in other organisms

This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree