miRNA miRCarta

m-409 in Ophiophagus hannah

Accession m-409
Sequence (5' -> 3') (23 nts)  AGGUUGGGAUCGGUUGCAAUGCU
Sequence (5' -> 3') with flanks CAGGUUGGGAUCGGUUGCAAUGCUGUG
similar to miRNAs from miRBase hsa-miR-92a-1-5p (MIMAT0004507)
oha-miR-92a-5p (MIMAT0036958)
Located in precursor oha-409-9.1
AZIM01002132.1:157,764-157,786 (-)
MFE -1.90 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree