miRNA miRCarta

m-396 in Capra hircus

Accession m-396
Sequence (5' -> 3') (23 nts)  CAAGCUCGCUUCUAUGGGUCUGU
Sequence (5' -> 3') with flanks ACAAGCUCGCUUCUAUGGGUCUGUGUC
similar to miRNAs from miRBase aca-miR-99a-3p (MIMAT0021997)
chi-miR-99a-3p (MIMAT0036313)
gga-miR-99a-3p (MIMAT0006781)
hsa-miR-99a-3p (MIMAT0004511)
tgu-miR-99-3p (MIMAT0014635)
Located in precursor chi-64-396.1
cluster_1:19,043,088-19,043,110 (-)
MFE -3.00 kcal/mol
first miRCarta version 1.0
last miRCarta version 1.1
This website uses Matomo Analytics and cookies. For more information, please refer to the privacy notice for our websites. Learn moreI agree